Review



gene read size selection kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Qiagen gene read size selection kit
    Gene Read Size Selection Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 351 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+read+size+selection+kit/GeneRead+Size+Selection+Kit/10__1007_slash_s10228___025___01041___y-34-30-35
    Average 96 stars, based on 351 article reviews
    gene read size selection kit - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Essential role of ThPOK autoregulatory loop in maintenance of mature CD4 T cell identity and function
    Article Snippet: Barcoding and amplification was performed using Nextera Index Kit (Illumina, FC-121-1011), as previously described 56 . .. Amplified ATAC-seq libraries were purified using Gene-Read Size Selection Kit (Qiagen, 180514) according to the manufacturer’s protocol. .. Quality and quantity of final ATAC-seq libraries were assessed with the High Sensitivity DNA kit (Agilent, 5067-4626) run on an Agilent 2100 Bioanalyzer.

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: Synthesized cDNAwas amplified by Prime star GXL (Takara) following themanufacturer’s instructions, with Ad1 and Ad2-2 primers. .. The PCR amplification conditions were followed by 14 cycles for 1000 cells with anti-Pol II Ser5P antibody, 15 cycles for 1000 cells with anti-Pol II Ser2P antibody, 16 cycles for 100 cells or embryos with anti-Ser5P antibody, or 17 cycles for 100 cells or embryos with anti-Ser2P antibody at 95 C for 10 s, 60 C for 15 s and 68 C for 100 min. We used corresponding IgGs as negative controls in our manuscript, considering that a similar result to the IgG negative control was obtained when no primary control was added in Harada et al.37 After amplification, small fragments (<150 bp) were removed using Gene read Size selection kit (Qiagen) and large size of fragments (>600 bp) were removed using AMPure XP beads (Beckman Coulter) according to the manufacture’s instruction. ..

    Purification:

    Article Title: Essential role of ThPOK autoregulatory loop in maintenance of mature CD4 T cell identity and function
    Article Snippet: Barcoding and amplification was performed using Nextera Index Kit (Illumina, FC-121-1011), as previously described 56 . .. Amplified ATAC-seq libraries were purified using Gene-Read Size Selection Kit (Qiagen, 180514) according to the manufacturer’s protocol. .. Quality and quantity of final ATAC-seq libraries were assessed with the High Sensitivity DNA kit (Agilent, 5067-4626) run on an Agilent 2100 Bioanalyzer.

    Article Title: Development of an improved colonization system for human-derived Bifidobacterium longum subsp. longum in conventional mice through the feeding of raffinose or 1-kestose
    Article Snippet: .. The samples were then mixed in equal molar ratios and purified using a Gene Read Size Selection Kit (Qiagen). .. The purified samples were processed using an Illumina MiSeq and MiSeq Reagent Kit V3 (600 cycles; Illumina Inc.).

    Article Title: The genetic distinctiveness of Lethenteron satoi (Petromyzontidae) confirmed by nuclear SNP markers
    Article Snippet: The 2nd PCR was conducted using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, Ipswich, MA, USA) under the following cycling conditions: 98°C for 30 s, 54°C for 15 s and 68°C for 30 s, for 20 cycles. .. The products of the 2nd PCR for each individual were pooled, and DNA fragments of 300–800 bp were isolated and purified using SPRIselect (Beckman Coulter, Brea, CA, USA) and the Gene Read Size Selection kit (Qiagen, Hilden, Germany). .. Fragment size and final concentration were verified using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Phylogeography of a salmonid fish, white-spotted charr (<i>Salvelinus leucomaenis</i>), in a historically non-glaciated region in the northwestern North Pacific
    Article Snippet: 1Nikko Field Station, Fisheries Technology Institute, Japan Fisheries Research and Education Agency, Nikko, Tochigi 321-1661, Japan 2The University of Tokyo, Kashiwa, Chiba 277-8564, Japan 3Nagano Environmental Conservation Research Institute, Nagano, Nagano 381-0075, Japan 4Lake Biwa Museum, Kusatsu, Shiga 525-0001, Japan 5Graduate School of Science, Kyoto University, Sakyo, Kyoto 606-8502, Japan 6Hokkaido University, Sapporo, Hokkaido 060-0811, Japan

    Size Selection:

    Article Title: Essential role of ThPOK autoregulatory loop in maintenance of mature CD4 T cell identity and function
    Article Snippet: Barcoding and amplification was performed using Nextera Index Kit (Illumina, FC-121-1011), as previously described 56 . .. Amplified ATAC-seq libraries were purified using Gene-Read Size Selection Kit (Qiagen, 180514) according to the manufacturer’s protocol. .. Quality and quantity of final ATAC-seq libraries were assessed with the High Sensitivity DNA kit (Agilent, 5067-4626) run on an Agilent 2100 Bioanalyzer.

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Article Title: Development of an improved colonization system for human-derived Bifidobacterium longum subsp. longum in conventional mice through the feeding of raffinose or 1-kestose
    Article Snippet: .. The samples were then mixed in equal molar ratios and purified using a Gene Read Size Selection Kit (Qiagen). .. The purified samples were processed using an Illumina MiSeq and MiSeq Reagent Kit V3 (600 cycles; Illumina Inc.).

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: Synthesized cDNAwas amplified by Prime star GXL (Takara) following themanufacturer’s instructions, with Ad1 and Ad2-2 primers. .. The PCR amplification conditions were followed by 14 cycles for 1000 cells with anti-Pol II Ser5P antibody, 15 cycles for 1000 cells with anti-Pol II Ser2P antibody, 16 cycles for 100 cells or embryos with anti-Ser5P antibody, or 17 cycles for 100 cells or embryos with anti-Ser2P antibody at 95 C for 10 s, 60 C for 15 s and 68 C for 100 min. We used corresponding IgGs as negative controls in our manuscript, considering that a similar result to the IgG negative control was obtained when no primary control was added in Harada et al.37 After amplification, small fragments (<150 bp) were removed using Gene read Size selection kit (Qiagen) and large size of fragments (>600 bp) were removed using AMPure XP beads (Beckman Coulter) according to the manufacture’s instruction. ..

    Article Title: The Impact of Early Life Experiences and Gut Microbiota on Neurobehavioral Development in Preterm Infants: A Longitudinal Cohort Study
    Article Snippet: PCR products were normalized based on the concentration of DNA in the 350–400 bp region and pooled using the QIAgility liquid handling robot (Qiagen). .. Pooled PCR products were cleaned using the Gene Read Size Selection kit (Qiagen) according to the manufacturer’s protocol. .. The cleaned pool was sequenced with the MiSeq using a v2 2 × 250 base-pair kit (Illumina, Inc., San Diego, CA, USA).

    Article Title: The genetic distinctiveness of Lethenteron satoi (Petromyzontidae) confirmed by nuclear SNP markers
    Article Snippet: The 2nd PCR was conducted using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, Ipswich, MA, USA) under the following cycling conditions: 98°C for 30 s, 54°C for 15 s and 68°C for 30 s, for 20 cycles. .. The products of the 2nd PCR for each individual were pooled, and DNA fragments of 300–800 bp were isolated and purified using SPRIselect (Beckman Coulter, Brea, CA, USA) and the Gene Read Size Selection kit (Qiagen, Hilden, Germany). .. Fragment size and final concentration were verified using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Phylogeography of a salmonid fish, white-spotted charr (<i>Salvelinus leucomaenis</i>), in a historically non-glaciated region in the northwestern North Pacific
    Article Snippet: 1Nikko Field Station, Fisheries Technology Institute, Japan Fisheries Research and Education Agency, Nikko, Tochigi 321-1661, Japan 2The University of Tokyo, Kashiwa, Chiba 277-8564, Japan 3Nagano Environmental Conservation Research Institute, Nagano, Nagano 381-0075, Japan 4Lake Biwa Museum, Kusatsu, Shiga 525-0001, Japan 5Graduate School of Science, Kyoto University, Sakyo, Kyoto 606-8502, Japan 6Hokkaido University, Sapporo, Hokkaido 060-0811, Japan

    Reverse Transcription:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Membrane:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    DNA Library Preparation:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    RNA Sequencing:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Chromatin Immunoprecipitation:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Crocin Bleaching Assay:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Recombinant:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Plasmid Preparation:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-SPT5 Santa Cruz Cat#sc-136075; RRID:AB_2286723 Mouse anti-NELF-A Abcam Cat#ab167675; RRID:AB_2927462 Rabbit anti-NELF-B Abcam Cat#ab167401; RRID:AB_2721176 Rabbit anti-NELF-C/D Abcam Cat#ab170934; RRID:AB_2927463 Rabbit anti-NELF-E Abcam Cat#ab170104; RRID:AB_2827280 Goat IgG Santa Cruz Cat#sc-2028; RRID:AB_737167 Rabbit anti-Pol II Ser5P Abcam Cat#ab5131; RRID:AB_449369 Rabbit anti-Pol II Ser2P Abcam Cat#ab5095; RRID:AB_304749 Rabbit IgG Cell Signaling Cat#2729S; RRID:AB_1031062 Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A32731; RRID:AB_2633280 Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A11029; RRID:AB_2534088 Goat anti-Rabbit IgG Secondary Antibody, Cy3 Invitrogen Cat#A10520; RRID:AB_2534029 Donkey anti-rabbit IgG Jackson ImmunoResearch Laboratories Cat#711-005-152; RRID:AB_2340585 Biological samples Mouse pre-implantation embryos This paper N/A Chemicals, peptides, and recombinant proteins 5,6-Dichlorobenzimidazole 1-b-Dribofuranoside (DRB) Santa Cruz Cat#sc-200581 BAY1251152 Selleckchem Cat#S8730 CHIR99021 Cayman Chemical Company Cat#13122 PD0325901 Cayman Chemical Company Cat#13034 Dimethyl sulfoxide Sigma Aldrich Cat#41639 RNasin Promega Cat#N2511 Pregnant Mare Serum Gonadotropin (PMSG) Ceva PREGMAGON human Chorionic Gonadotrophin (hCG) MSD Animal Health OVOGEST DMEM, high glucose, GlutaMAX Supplement, pyruvate Gibco Cat#31966021 FBS PAN BIOTECH Cat#P30-3302 2-mercaptoethanol Gibco Cat#21985023 Non-essential amino acids Gibco Cat#11140–050 Penicillin Streptomycin Gibco Cat#15070–063 LIF Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) N/A Gelatine solution PAN BIOTECH Cat#P06-20410 KSOM This paper N/A Vectashield Vector Laboratories Cat#H-2000 DBCO-PEG5-NHS ester Santa Cruz Cat#sc-499348 Tn5 transposase Glow Biologics Cat#GBRP-TN5 TAPS MP Biomedicals Cat#103007 N,N-dimethylformamide Sigma Aldrich Cat#D4551 T4 DNA ligase New England Biolab Cat#M0202 T4 DNA polymerase New England Biolab Cat#M0203 (Continued on next page) e1 Cell Reports 41, 111865, December 27, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER T7 RNA polymerase New England Biolab Cat#M0251 DNase I Thermo Scientific Cat#AM2238 SMARTScribe reverse transcriptase Takara Cat#639536 Prime star GXL Takara Cat#R050A Proteinase K Sigma Aldrich Cat#P6556 ERCC RNA Spike in Mix Invitrogen Cat#4456740 SuperScript III Reverse Transcriptase Invitrogen Cat#18080093 KAPA HiFi ReadyMix Roche Cat#KK2602 Critical commercial assays mMESSAGE mMACHINE kit (Ambion) Invitrogen Cat#AM1344 Amicon Ultra–0.5 mL, 30 kDa or 100 kDa centrifugal filters Millipore Cat#UFC503008, Cat#UFC510024 PD MinitrapTM G-25 GE Healthcare Cat#GE28-9180-07 Microcon Ultracel DNA Fast Flow Membrane Millipore Cat#MRCF0R100 RNeasy MinElute Cleanup kit Qiagen Cat#74204 Gene read Size selection kit Qiagen Cat#180514 AMPure XP beads Beckman Coulter Cat#A63882 RNAclean XP beads Beckman Coulter Cat#A66514 NEBNext Ultra II DNA Library Prep Kit New England Biolab Cat#E7645S Nextera XT DNA Library Preparation Kit Illumina Cat#FC-131-1096 Deposited data Raw data This paper GEO: GSE195840 RNA-seq data Deng et al., 201442 GEO: GSE45719 Stacc-seq data Liu et al., 202035 GEO: GSE135457 H3K36me3 ChIP-seq data Xu et al., 201948 GEO: GSE112835 ATAC-seq data Wu et al., 201674 GEO: GSE66390 Experimental models: Cell lines Mouse: E14 embryonic stem cells Miyanari and Torres-Padilla, 201275 RRID:CVCL_C320 Experimental models: Organisms/strains Mouse: C57BL/6J 3 CBA/H F1 mouse Janvier labs RRID:MGI:5650652 Oligonucleotides Probe: ChIL DNA Fw Sigma-Aldrich N/A Probe: ChIL DNA Rv Sigma-Aldrich N/A Read2-2 primer: CGGAGATGTGTATAAGAG ACAGNNNNNN Sigma-Aldrich N/A Ad1 primer: AATGATACGGCGACCACCGAGAT CTACACTCGTCGGCAGCGTCAGATGTG Sigma-Aldrich N/A Ad2-2 primer: CAAGCAGAAGACGGCATAC GAGAT[8mer_index]GTCTCGTGGGCTCG GAGATGTGTATAAGAGACAG Sigma-Aldrich N/A Oligo dT primer: AAGCAGTGGTATCAACGC AGAGTACT30VN Biomers.net N/A Template switching oligo: AAGCAGTGGTATCAA CGCAGAGTACATrGrG+G Exiqon N/A ISPCR oligo: AAGCAGTGGTATCAACGCAGAGT Biomers.net N/A Recombinant DNA Plasmid: pGEMHE-mCherry-mTrim21 Clift et al., 201752 Addgene plasmid: 105522 (Continued on next page) Cell Reports 41, 111865, December 27, 2022 e2 Article ll OPEN ACCESS ..

    Polymerase Chain Reaction:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: Synthesized cDNAwas amplified by Prime star GXL (Takara) following themanufacturer’s instructions, with Ad1 and Ad2-2 primers. .. The PCR amplification conditions were followed by 14 cycles for 1000 cells with anti-Pol II Ser5P antibody, 15 cycles for 1000 cells with anti-Pol II Ser2P antibody, 16 cycles for 100 cells or embryos with anti-Ser5P antibody, or 17 cycles for 100 cells or embryos with anti-Ser2P antibody at 95 C for 10 s, 60 C for 15 s and 68 C for 100 min. We used corresponding IgGs as negative controls in our manuscript, considering that a similar result to the IgG negative control was obtained when no primary control was added in Harada et al.37 After amplification, small fragments (<150 bp) were removed using Gene read Size selection kit (Qiagen) and large size of fragments (>600 bp) were removed using AMPure XP beads (Beckman Coulter) according to the manufacture’s instruction. ..

    Article Title: The Impact of Early Life Experiences and Gut Microbiota on Neurobehavioral Development in Preterm Infants: A Longitudinal Cohort Study
    Article Snippet: PCR products were normalized based on the concentration of DNA in the 350–400 bp region and pooled using the QIAgility liquid handling robot (Qiagen). .. Pooled PCR products were cleaned using the Gene Read Size Selection kit (Qiagen) according to the manufacturer’s protocol. .. The cleaned pool was sequenced with the MiSeq using a v2 2 × 250 base-pair kit (Illumina, Inc., San Diego, CA, USA).

    Article Title: The genetic distinctiveness of Lethenteron satoi (Petromyzontidae) confirmed by nuclear SNP markers
    Article Snippet: The 2nd PCR was conducted using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, Ipswich, MA, USA) under the following cycling conditions: 98°C for 30 s, 54°C for 15 s and 68°C for 30 s, for 20 cycles. .. The products of the 2nd PCR for each individual were pooled, and DNA fragments of 300–800 bp were isolated and purified using SPRIselect (Beckman Coulter, Brea, CA, USA) and the Gene Read Size Selection kit (Qiagen, Hilden, Germany). .. Fragment size and final concentration were verified using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA).

    Negative Control:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: Synthesized cDNAwas amplified by Prime star GXL (Takara) following themanufacturer’s instructions, with Ad1 and Ad2-2 primers. .. The PCR amplification conditions were followed by 14 cycles for 1000 cells with anti-Pol II Ser5P antibody, 15 cycles for 1000 cells with anti-Pol II Ser2P antibody, 16 cycles for 100 cells or embryos with anti-Ser5P antibody, or 17 cycles for 100 cells or embryos with anti-Ser2P antibody at 95 C for 10 s, 60 C for 15 s and 68 C for 100 min. We used corresponding IgGs as negative controls in our manuscript, considering that a similar result to the IgG negative control was obtained when no primary control was added in Harada et al.37 After amplification, small fragments (<150 bp) were removed using Gene read Size selection kit (Qiagen) and large size of fragments (>600 bp) were removed using AMPure XP beads (Beckman Coulter) according to the manufacture’s instruction. ..

    Control:

    Article Title: Distinct patterns of RNA polymerase II and transcriptional elongation characterize mammalian genome activation.
    Article Snippet: Synthesized cDNAwas amplified by Prime star GXL (Takara) following themanufacturer’s instructions, with Ad1 and Ad2-2 primers. .. The PCR amplification conditions were followed by 14 cycles for 1000 cells with anti-Pol II Ser5P antibody, 15 cycles for 1000 cells with anti-Pol II Ser2P antibody, 16 cycles for 100 cells or embryos with anti-Ser5P antibody, or 17 cycles for 100 cells or embryos with anti-Ser2P antibody at 95 C for 10 s, 60 C for 15 s and 68 C for 100 min. We used corresponding IgGs as negative controls in our manuscript, considering that a similar result to the IgG negative control was obtained when no primary control was added in Harada et al.37 After amplification, small fragments (<150 bp) were removed using Gene read Size selection kit (Qiagen) and large size of fragments (>600 bp) were removed using AMPure XP beads (Beckman Coulter) according to the manufacture’s instruction. ..

    Isolation:

    Article Title: The genetic distinctiveness of Lethenteron satoi (Petromyzontidae) confirmed by nuclear SNP markers
    Article Snippet: The 2nd PCR was conducted using Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs, Ipswich, MA, USA) under the following cycling conditions: 98°C for 30 s, 54°C for 15 s and 68°C for 30 s, for 20 cycles. .. The products of the 2nd PCR for each individual were pooled, and DNA fragments of 300–800 bp were isolated and purified using SPRIselect (Beckman Coulter, Brea, CA, USA) and the Gene Read Size Selection kit (Qiagen, Hilden, Germany). .. Fragment size and final concentration were verified using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Phylogeography of a salmonid fish, white-spotted charr (<i>Salvelinus leucomaenis</i>), in a historically non-glaciated region in the northwestern North Pacific
    Article Snippet: 1Nikko Field Station, Fisheries Technology Institute, Japan Fisheries Research and Education Agency, Nikko, Tochigi 321-1661, Japan 2The University of Tokyo, Kashiwa, Chiba 277-8564, Japan 3Nagano Environmental Conservation Research Institute, Nagano, Nagano 381-0075, Japan 4Lake Biwa Museum, Kusatsu, Shiga 525-0001, Japan 5Graduate School of Science, Kyoto University, Sakyo, Kyoto 606-8502, Japan 6Hokkaido University, Sapporo, Hokkaido 060-0811, Japan



    Similar Products

    96
    Qiagen gene read size selection kit
    Gene Read Size Selection Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+read+size+selection+kit/GeneRead+Size+Selection+Kit/10__1007_slash_s10228___025___01041___y-34-30-35
    Average 96 stars, based on 1 article reviews
    gene read size selection kit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Qiagen gene read
    Gene Read, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+read+size+selection+kit/GeneRead+Size+Selection+Kit/pmc12272802-127-15-17
    Average 96 stars, based on 1 article reviews
    gene read - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Qiagen gene read pure mrna kit
    Gene Read Pure Mrna Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+read+size+selection+kit/GeneRead+Size+Selection+Kit/pm38862878-94-29-34
    Average 96 stars, based on 1 article reviews
    gene read pure mrna kit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results